Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0072765 | |||
Gene | CCNB1 | Organism | Human |
Genome Locus | chr5:68471223-68471364:+ | Build | hg19 |
Disease | Irradiated Hepatic Stellate Cell (HSC) | ICD-10 | Fibrosis and cirrhosis of liver (K74) |
DBLink | Link to database | PMID | 28774651 |
Experimental Method | |||
Sample Type | LX2 Cell lines | Comparison | two cell cultural groups (normal Hepatic Stellate Cells (HSC) vs. irradiated Hepatic Stellate Cells (HSC)) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward TTGCAGCAGGAGCTTTTTGC ReverseGGCCAAAGTATGTTGCTCGAC | Statistics | Fold Change : Upregulated,4.228591 pvalue : p=0.031508 |
Citation | |||
Chen, Y, Yuan, B, Wu, Z, Dong, Y, Zhang, L, Zeng, Z (2017). Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. Gene, 629:35-42. |